点击下载原文.pdf

Plant Physiology and Biochemistry 64 (2013) 52e59 Contents lists available at SciVerse ScienceDirect Plant Physiology and Biochemistry journal homepage: www.elsevier.com/locate/plaphy Research article A novel salt-induced gene from sheepgrass, LcSAIN2, enhances salt tolerance in transgenic Arabidopsis Xiaoxia Li a, b,1, Qiong Gao a, b,1, Ye Liang a, b, Tian Ma c, Liqin Cheng a, Dongmei Qi a, Hui Liu a, Xin Xu c, Shuangyan Chen a, *, Gongshe Liu a, ** a Key Laboratory of Plant Resources, Institute of Botany, The Chinese Academy of Sciences, Beijing, PR China Graduate School of the Chinese Academy of Sciences, Beijing, PR China c Ningxia University, PR China b a r t i c l e i n f o a b s t r a c t Article history: Received 12 November 2012 Accepted 19 December 2012 Available online 7 January 2013 Salt stress affects plant growth and development, and limits the productivity of crops. Sheepgrass can grow well under various environmental and soil conditions and is a good wild resource in Triticeae. Using 454 high throughout sequencing technique, a large number of salt stress responsive genes have been picked out from sheepgrass. In this study, a novel salt-induced gene and its promoter were cloned and the gene was designated as LcSAIN2 (Leymus chinensis salt-induced 2). Bioinformatics analysis predicted that LcSAIN2 has one transmembrane helix and is localized in nucleus. Experiments of subcellular localization in tobacco leaf cells also indicated that it was mainly localized in nucleus. Several stress responsive elements were found in the promoter region of the LcSAIN2 gene. The expression analysis conﬁrmed that LcSAIN2 was induced by salinity, PEG, ABA, and cold stresses, especially by high salinity. Overexpression of LcSAIN2 in Arabidopsis enhanced salt tolerance of transgenic plants by accumulating osmolytes, such as soluble sugars and free proline, and improving the expression levels of some stress-responsive transcription factors and key genes. Our results suggest that LcSAIN2 might play an important positive modulation role in salt stress tolerance and be a candidate gene utilized for enhancing stress tolerance in wheat and other crops. Ó 2013 Elsevier Masson SAS. All rights reserved. Keywords: LcSAIN2 Novel salt-induced gene Salt tolerance Sheepgrass Arabidopsis 1. Introduction Adverse environmental stresses affect plant growth and crop yields [1]. To cope with various environment stresses, plants have developed various adjustment mechanisms to defense and adapt to stress conditions [2,3]. Extensive stress-induced genes have been identiﬁed and characterized to elucidate the mechanisms by which plant respond to salinity stress, including transcription factors, enzymes, molecular chaperones, ion channels, receptor, signaling molecules, and the genes involved in producing compatible solutes (e.g., soluble sugar and proline), resulting in stress tolerance [4e8]. The molecular regulatory mechanisms in the expression of stressresponsible genes can be mainly divided into ABA-dependent and ABA-independent regulatory pathways [9e12]. Despite the above described salinity resistant genes in model plants and crops, wild species can adapt harsh environments and * Corresponding author. Tel.: þ86 10 62836242; fax: þ86 10 62836227. ** Corresponding author. Tel./fax: þ86 10 62836227. E-mail addresses: sychen@ibcas.ac.cn (S. Chen), liugs@ibcas.ac.cn (G. Liu). 1 These authors contributed equally to this work. 0981-9428/$ e see front matter Ó 2013 Elsevier Masson SAS. All rights reserved. http://dx.doi.org/10.1016/j.plaphy.2012.12.014 soil conditions and has rich stress resistance genes worth to explore. Sheepgrass (Leymus chinensis (Trin.) Tzvel) belongs to Leymus genus (Gramineae: Triticeae) and is an important forage species for livestock in the steppes of northern Eurasia and China [13,14]. It can grow and develop well in high salt (600 mM NaCl) and drought stress, and it also can withstand extreme low temperature stress. Although they have close phylogenetic relationship, sheepgrass has signiﬁcantly higher stress tolerance than wheat or barley [15,16]. Intergeneric hybrids of wheat and Leymus demonstrated that the hybrid wheat exhibited higher stress tolerance than the control, suggesting the transfer of resistance genes from Leymus to wheat might support wheat improvement [17e19]. Therefore, sheepgrass can be an excellent gene pool for molecular breeding to enhance stress tolerance in wheat and other Triticeae crops. In a previous study we found a large number of stress responsive genes in sheepgrass via a 454 high throughout sequencing technique. Some genes have been identiﬁed and found that they can improve drought and salt tolerance of transgenic Arabidopsis thaliana [20]. In order to validate more useful genes for crop improvement, we further isolate a novel stress inducible gene LcSAIN2, characterize its expression pattern under different stress X. Li et al. / Plant Physiology and Biochemistry 64 (2013) 52e59 treatments, and speculate upon its structure and regulatory mechanism in salt stress tolerance. 2. Results 2.1. Isolation and characterization of LcSAIN2 A partial cDNA sequence of an unknown function stress-induced gene designated as LcSAIN2 was previously isolated via 454 high throughout sequencing, and the full length of gene was obtained by the RACE technique. LcSAIN2 (GenBank accession number: JX861860) had a full length of 1025 bp including 50 untranslated region of 205 bp and 30 untranslated region of 64 bp. It contained a 756 bp open reading frame encoding a protein with 251 amino acids, which showed higher homologies (67%) with a wheat cDNA clone: WT003_F22 (GenBank accession number: AK332187.1). Genomic sequence was ampliﬁed and analyzed, suggesting that the gene did not contain introns. The SignalP 4.0 server predicted the presence of an N-terminal signal peptide in the protein and its cleavage sites was between the 32 and 33 amino acids (Fig. 1a). The 53 TMHMM 2.0 server predicted one transmembrane helix between residues 219 and 241 (Fig. 1b). To identify the putative cis-acting regulatory elements, about 1150 bp of sequence upstream from the start codon was isolated. Possible stress related ABA-responsive ciselements ACGT, MYB and MYC recognition site elements were identiﬁed in sequence upstream of the LcSAIN2 gene (Table 2). 2.2. Expression pattern of LcSAIN2 in different tissues and response to abiotic stresses The qRT-PCR was performed to determine the expression pattern of LcSAIN2 in different tissues. Transcripts of LcSAIN2 under control conditions were primarily observed in roots, with less in leaves, the sheath, panicle and stems (Fig. 2a). To analyze the effect of stresses on the expression of LcSAIN2, the sheepgrass seedlings were exposed to diverse abiotic stresses. Semiquantitative RT-PCR and qRT-PCR was performed using the total RNA extracted from 4-week and 8-week sheepgrass plants subjected to stress treatments at different time intervals. The time-dependent expression proﬁling revealed different transcript regulation Fig. 1. Sequence analysis of LcSAIN2. a. SignalP 4.0 server predicts the presence of an N-terminal signal peptide. b. TMHMM 2.0 server predicted transmembrane helix. 54 X. Li et al. / Plant Physiology and Biochemistry 64 (2013) 52e59 Table 1 Primer sequences used for RT-PCR and qRT-PCR. Name Squence Name Sequence Function LcACTIN-S LcSAIN2-S LcACTIN-S LcSAIN2-S AtACTIN2-S AtMYB2-S AtRD26-S AtRD29B-S AtRAB18-S GCACCCTGTGTTGCTCACT TATGCTGTCTGCCGCTGCTC GTGCTTTCCCTCTATGCAAGTGGT TCCTCTTTCGCTTCTCTCTCCTC TGCTGACCGTATGAGCAAAG AACGTCTTCGAATTCTCCGGCTGA GCACGAGTATCGCTTAATAGAACA GCAAGCAGAAGAACCAATCA CCACGAGAAGAAGGGGATGAT LcACTIN-AS LcSAIN2-AS LcACTIN-AS LcSAIN2-AS AtACTIN2-AS AtMYB2-AS AtRD26-AS AtRD29B-AS AtRAB18-AS TACCTTGATCTTCATGCTGCTC TCCACCGCCGTCTATGCTC CTGTTCTTGGCAGTCTCCAGCTC TCAACGGCATAACGCCAGTC GATTGATCCTCCGATCCAGA ATCGTTGAACTCTCCGAAACCCGT CGACACAACACCCAATCATC CTTTGGATGCTCCCTTCTCA CGAATGCGACTGCGTTACAA RT-PCR RT-PCR qPCR qPCR qPCR qPCR qPCR qPCR qPCR patterns for LcSAIN2 in response to various abiotic stresses. Seedlings treated with cold showed a highest transcript levels at 12 h. Treatment with PEG and ABA also led to a signiﬁcant increase in transcript levels after 3 h and the highest at 12 h (Fig. 2b, c). For salt treatment, 4-weeks old sheepgrass plants subjected to 400 mM NaCl, LcSAIN2 transcript levels showed an increase at 3 h, detected by semi-quantitative RT-PCR (Fig. 2b). In addition, the LcSAIN2 expression patterns of roots and shoots under salt treatment were also studied by qRT-PCR using 8-week old sheepgrass. As shown in Fig. 2d, the transcription level of LcSAIN2 in the roots was nearly the same as in the shoots, and the transcription level increased after 1 h under salt stress. These results indicated that LcSAIN2 was responsive to salt stress and other abiotic stresses. 2.3. Subcellular localization of LcSAIN2 To determine the subcellular localization of LcSAIN2 in vivo, the open reading frame sequence was inserted into the vector pMDC45 fused with GFP reporter gene under the control of the CaMV 35S promoter, and transiently expressed in tobacco (Nicotiana tabacum) leaf cells. The vector pMDC45 was as a control. Fluorescent signals from pMDC45-LcSAIN2::GFP was mainly detected in the nucleus and weakly in the plasma membrane, while pMDC45::GFP alone were present throughout the whole cell (Fig. 3). 2.4. Over-expression of LcSAIN2 increases tolerance to salt stress In order to analyze the function of LcSAIN2, salt tolerance of the WT and transgenic LcSAIN2 plants were tested. WT and transgenic seeds were germinated on MS medium plates for 7 days and then transferred to MS plates supplemented 150 mM NaCl treatment. After 3 weeks of treatment most of WT seedlings were albinos and wilting (Fig. 4a). Under normal growth conditions, no obvious differences were detected in either WT or transgenic seedlings. Furthermore, survival rates were also determined. As shown in Fig. 4b, the two transgenic lines showed signiﬁcantly higher survival rates of 72% and 74%, respectively, as compared to the WT plants (w30%) (Fig. 4b). To study the role of LcSAIN2 in enhancing the salinity stress on root growth, four-day-old seedlings were shifted to agar medium containing 100e200 mM NaCl. Seven days later, root elongation was measured. Root elongation was signiﬁcantly higher in transgenic plants compared to WT plants at 150 mM NaCl (Fig. 4c). 2.5. Soluble sugars and proline content under salt tolerance in transgenic Arabidopsis Previous studies indicated that plant adaptation to abiotic stress is related to the accumulation of soluble sugars and proline, and higher proline content under salt stress can facilitate plant tolerance to high salinity [32]. To explore the physiological and biochemical characteristics that may be responsible for improved tolerance of the transgenic plants to salt stress (150 mM NaCl) than WT plants, soluble sugars and proline content were determined. Our results suggested that the levels of soluble sugar were evaluated in both transgenic plants and control plants under salt stress conditions, but the increased levels of soluble sugar were signiﬁcantly higher in transgenic plants compared to control plants (Fig. 5a). Further, the analysis of proline content revealed similar levels in transgenic plants and wild type plants without salt treatment. However, after 1 or 2 days, proline contents were signiﬁcantly increased in both transgenic lines compared with WT (Fig. 5b). 2.6. Expression of stress-associated genes in transgenic Arabidopsis The relative expression levels of four previously identiﬁed stressassociated genes were measured in these transgenic over-expression Table 2 Prediction of stress response cis-acting element of LcSAIN2. Factor or site name Site Signal sequence Function ABRELATERD1 ACGTATERD1 CE1 TC-rich repeats MYB1AT MYB2CONSENSUSAT MYBCORE MYCATERD1 MYCCONSENSUSAT WRKY71OS 417 () 599() 418 (þ) 560 (þ) 418 () 560 () 702 () 42 () 477 (þ) 250 () 250 (þ) 606 (þ) 101 () 101 (þ) 606 (þ) 101 () 606 () 84 (þ) 43 () 413 () 485 () ACGTG ACGT TGCCACCGG GTTTTCTTAC WAACCA YAACKG CNGTTR CATGTG CANNTG TGAC WBOXHVISO1 WBOXNTERF3 TCA-element TGACG-motif DOFCOREZM 412 () 412 () 484 () 22 (þ) 44 (þ) 41 () 83 (þ) 27 (þ) 531 (þ) 536 (þ) 383 () 398 () 634 () 658 () TGACT TGACY CAGAAAAGGA TGACG AAAG ABA responsive element Early responsive to dehydration and dark-induced senescence Cis-acting element associated to ABRE, involved in ABA responsiveness Cis-acting element involved in defense and stress responsiveness MYB recognition site found in the promoters of the stress-responsive genes MYB recognition site found in the promoters of the stress-responsive genes Binding site for regulation of genes that are responsive to water stress MYC recognition sequence necessary for expression of erd1 in water-stress Regulates the transcription of CBF/DREB1 genes in the cold Binding site of rice WRKY71, a transcriptional repressor of the gibberellin signaling pathway Sugar-responsive elements of the iso1 promoter Found in the promoter region of a transcriptional repressor ERF3 gene Cis-acting element involved in salicylic acid responsiveness Cis-acting regulatory element involved in the MeJA-responsiveness Core site required for binding of Dof proteins X. Li et al. / Plant Physiology and Biochemistry 64 (2013) 52e59 55 Fig. 2. Expression pattern of LcSAIN2 in sheepgrass. a. Expression patterns of LcSAIN2 in different tissues. b. Expression of LcSAIN2 in 4 week seedlings under salinity, PEG, ABA, and cold treatment. c. Expression of LcSAIN2 in 8 week seedlings under cold, ABA and PEG treatment. The transcript level of LcSAIN2 at 0 h was used as control. d. Expression patterns of LcSAIN2 in roots and shoots under 400 mM NaCl treatment. lines using qRT-PCR. The expression of the ABA-induced gene RD29B and RAB18 was increased in LcSAIN2 transgenic plants compared with control plants. The transcription factors MYB2 and RD26 also exhibited increased expression levels in two transgenic lines (Fig. 6). 3. Discussion Using 454 high throughout sequencing and molecular biology technique, we have found a great number of salt stress responsive Fig. 3. Subcellular localization of the LcSAIN2 protein in tobacco epidermal cells. Transient expression of pMDC45-LcSAIN2 fusion and pMDC45 construct in tobacco epidermal cells. Green ﬂuorescence was observed using a confocal microscope at 48 h after A. tumefaciens inﬁltration. Micrographs showing cells expressing GFP (control, upper lane) or LcSAIN2::GFP (bottom lane) fusion protein. From left to right, the pictures showed ﬂuorophores, bright-ﬁeld, and overlay of two illuminations. Bar ¼ 25 mm. 56 X. Li et al. / Plant Physiology and Biochemistry 64 (2013) 52e59 Fig. 4. Overexpression of LcSAIN2 in transgenic plants enhanced resistance to salt stress. a. Growth of WT and transgenic lines treated with 150 mM NaCl. Seven-day-old seedlings were transferred to a medium containing 150 mM NaCl for three weeks before the images were taken. b. Survival rates of WT and transgenic seedlings were calculated after salt treatments. c. Measurements of root elongation in WT and transgenic plants. Four-day-old seedlings were shifted to agar medium containing various concentrations of NaCl for 7 d and the root elongating were recorded. For b and c, each column represents an average of three replicates, and bars indicate SDs. ** and * indicate signiﬁcant differences in comparison with the control at P < 0.01and P < 0.05, respectively. transcripts from sheepgrass. In the present study, we cloned a novel salt stress induced gene of LcSAIN2 and its promoter from these transcripts, which had relatively high homology (67%) with an unknown EST sequence of wheat. Several stress responsive elements were found in the promoter region of LcSAIN2 and the gene was signiﬁcantly induced by salinity, PEG, ABA, and cold stresses (Table 2, Fig. 2a). The TMHMM 2.0 server predicted that LcSAIN2 has one transmembrane helix and Plant-mPLoc program predicted that LcSAIN2 is localized in nucleus. Transient expression of LcSAIN2 in tobacco leaf cells also indicated that LcSAIN2 is mainly localized in the nucleus (Fig. 3). With a likely function in the nucleus [33,34], we speculate that LcSAIN2 is a stress responsive gene and may play roles in salt and other abiotic stresses response. Previous studies showed that overexpression of several transcription factors improved salinity stress tolerance in transgenic plants [35e38]. In the present study, we found that overexpression of LcSAIN2 in Arabidopsis also signiﬁcantly improved salt tolerance. This salt tolerance was supported by phenotypic performance and physiological indicator changes, such as survival rates, root elongation. The results revealed that the survival rates and root elongation were signiﬁcantly higher in transgenic lines than WT (Fig. 4). Plants may enhance stress tolerance by accumulating osmolytes, such as soluble sugars and free proline to adjust the osmotic potential and protect cell structures [39,40]. The increased soluble sugars and proline content under different environmental stresses signiﬁcantly improved plant stress tolerance [32,39,41,42]. To investigate the potential mechanisms underlying the improved stress tolerance of LcSAIN2 in overexpressed plants, the levels of soluble sugars and free proline were measured under salinity stress conditions. The results showed that the contents of soluble sugars and free proline in the transgenic plants were signiﬁcantly higher than those in WT plants under salt stress (Fig. 5). Therefore, we proposed that higher tolerance against salt stresses in transgenic Arabidopsis might be achieved by osmolytes accumulation. In order to dissect the enhanced salt tolerance at the molecular level, expression of four stress-responsive genes were monitored between the transgenic plants and control. Our results showed that overexpression of LcSAIN2 led to higher expression of all four stress-related genes (Fig. 6). It was well known that transcription factors MYB2 and RD26 involved in the ABA-dependent pathway and RD29B and RAB18 could be induced by different stresses through an ABA-dependent pathway, and that higher expression of these genes improved the plant tolerance to multiple stresses [11,35,37,38]. We inferred that LcSAIN2 might act as an activator to increase the expression of the above stress responsive genes to enhance tolerance of the transgenic plants under salt stress. In conclusion, this study identiﬁed and characterized a novel LcSAIN2 gene from sheepgrass. LcSAIN2 was induced by various abiotic stresses, but especially by salt stress. It was mainly localized in the nucleus. Overexpression of LcSAIN2 led to the up-regulated expression of several key stress responsive genes, greater accumulation of soluble sugars and free proline, and enhanced tolerance to salt stress in transgenic Arabidopsis. LcSAIN2 may also provide a useful gene for molecular breeding of important crops to improve stress tolerance. At present, the work of transforming LcSAIN2 into rice and introgressing wheat is in progress in our laboratory. X. Li et al. / Plant Physiology and Biochemistry 64 (2013) 52e59 57 treated with cold, NaCl, ABA and PEG. For cold stress treatment, plants were placed in a dark chamber at 4 C. For NaCl, abscisic acid (ABA) and drought stress treatments, seedlings were irrigated with 400 mM NaCl, 100 mM ABA and 20% PEG6000, respectively. Total of 15 plants were sampled per treatment at various intervals (0, 1, 3, 5, 12, 24, and 48 h). To determine the gene expression level of the shoots and roots under salt stress, the above and below ground of 8 week seedlings were sampled separately and stored at 80 C for RNA analysis. For expression analysis in different tissues, leaf, stem, sheath, panicle and root were collected from a 2-year-old sheepgrass grown in the greenhouse conditions as above described. A. thaliana plants (ecotype Columbia, Col-0) were grown in a soil mix of peat moss and vermiculite (2:1, v/v) at 23 C under a 16-h photoperiod. Transformed Arabidopsis seeds were sterilized in 30% (v/v) bleach for 15 min, rinsed ﬁve times with sterile water, and were selected on Murashige and Skoog (MS) agar supplemented with 30 mg ml1 hygromycin, transferred to the soil mix described above and then grown under the same conditions [21]. Tobacco (N. tabacum) seeds were grown in pots with peat moss and vermiculite (2:1, v/v) in greenhouse conditions at average temperature of 23 C under a 16/8 h day/night cycle. 4.2. Cloning of the LcSAIN2 gene and sequence analysis Fig. 5. Measurement of soluble sugars and proline content of transgenic and WT plants after 150 mM NaCl treatment. a. Soluble sugars content in transgenic and WT plants after 2 d treatment of 150 mM NaCl. b. Proline contents of transgenic and WT seedlings exposed to 150 mM NaCl for 1 d and 2 d. Each column represents an average of three replicates, and bars indicate SDs. ** and *** indicate signiﬁcant differences in comparison with the control at P < 0.01 and P < 0.001. 4. Materials and methods 4.1. Plant growth conditions and stress treatment Sheepgrass (variety Zhongke No 2) was grown in soil mix of peat moss and vermiculite (2:1, v/v) in the greenhouse at an average temperature of 23 C under long-day conditions (16 h light/8 h dark). For abiotic stress analyses, 4 or 8 week seedlings were Fig. 6. Relative expression levels of four stress associated genes in response to salt treatment. Three-week old Arabidopsis seedlings grown on MS growth medium were used for real-time quantitative PCR. Based on the transcriptomic data of sheepgrass using 454 high throughout sequencing technique, a lot of candidate salinity induced transcripts were identiﬁed. Among these transcripts, one of the transcripts, designated as LcSAIN2, was an unknown function gene and signiﬁcantly induced by salt stress treatment according to our previous experimental veriﬁcation. Therefore, we are interested in this gene and want to explore its function. To obtain the full-length cDNA of LcSAIN2, 2 weeks old sheepgrass (variety Zhongke No 2) seedlings were irrigated with 400 mM NaCl for 48 h were harvested. Total RNA was isolated using the Trizol Kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The full-length cDNA sequence was ampliﬁed using a SMARTÔ RACE cDNA Ampliﬁcation Kit (Clontech, Japan) and sequenced. The RACE primers used in the present study are: 5GSP 50 -CTCCAAATCCACCGCCGTCTATGC-30 and 3GSP 50 GATGTGCTGTCTGCCGCTGCTCC-30 . Genomic DNA was prepared from seedlings of sheepgrass using the Plant Genomic DNA Rapid Extraction kit (Bioteke Corporation, China). The genomic DNA sequence was ampliﬁed by PCR using 50 -TGGCTCTCATTTCTCC TCTTTCG-30 forward primer and 50 -CCAGAAGGACCCAGGCTTC-30 reverse primer. The obtained full-length cDNA and genomic DNA sequences of LcSAIN2 were further analyzed. Sequence assembling was performed using DNAMAN v5.0 (Lynnon Biosoft Inc., Vandreuil, Quebec, Canada), and SignalP4.0 [22] was used to predict the signal peptide. The transmembrane segments in protein were predicted using TMHMM 2.0 [23]. The subcellular localization of LcSAIN2 protein was predicted using Plant-mPLoc program [24]. To identify the putative cis-acting regulatory elements, the promoter sequence was isolated using TAIL-PCR [25] with the gene speciﬁc primers of SP1 50 -TATGCTGACGAACCCCATCTGC-30 , SP2 50 CAGAAAACGAAGCCACGCAGAG-30 and SP3 50 -AGCGGCAGACAGCACATCAA-30 , and three arbitrary degenerate (AD) primers of AD1 50 NTCGA(G/C)T(A/T)T(G/C)G(A/T)GTT-30 , AD2 50 -NGTCGA(G/C)(A/T) GANA(A/T)GAA-30 and AD3 50 -(A/T)GTGNAG(A/T)ANCANAGA-30 . PCR procedure was performed as described by Liu et al. [25]. Promoter cis-elements were identiﬁed using the algorithm developed by Higo et al. [26] which are available at www.dna.affrc.go.jp/ PLACE/index.html. 58 X. Li et al. / Plant Physiology and Biochemistry 64 (2013) 52e59 4.3. Expression analysis Total RNA was extracted from both Arabidopsis and sheepgrass seedlings and the cDNA was reverse transcribed using the abovementioned protocols. LcACTIN and AtACTIN2 (Table 1) were used as internal reference genes for assessing expression levels in sheepgrass and Arabidopsis, respectively. For semi-quantitative RTPCR, the following programs were used, 5 min denaturation at 94 C, followed by 28 cycles of 94 C for 30 s, 56 C for 30 s, 72 C for 30 s, completed by an extension step of 10 min 72 C. SYBRÒ PrimeScriptÔ PCR Kit (TaKaRa, Japan) was used for quantitative RTPCR (qRT-PCR). Each 20 ml qRT-PCR was subjected 40 cycles of 94 C for 5 s and 60 C for 20 s. Each qRT-PCR was run in triplicate. After the PCR program, data were quantiﬁed using the comparative CT method (2DDCT method) [27]. All semi-quantitative RT-PCR and qRT-PCR experiments described in this section were reproduced at least three times using independent cDNA preparations. Primer sequences for semi-quantitative RT-PCR and qRT-PCR are listed in Table 1. 4.4. Tobacco transient expression and confocal microscopy The LcSAIN2 gene was combined with green ﬂuorescent protein (GFP) to yield a fusion protein. The open reading frame (ORF) sequence of the gene was recombined into the vector pMDC45 (pCAMBIA1300) under the control of the Cauliﬂower mosaic virus (CaMV) 35S promoter were used to transform Agrobacterium tumefaciens (EHA105) cells. The intact leaves of 4-week-old wild type tobacco (N. tabacum) plants were injected with A. tumefaciens strain EHA105 harboring pMDC45 and pMDC45-LcSAIN2, respectively. Transgene-derived expression was monitored 2e3 d after inﬁltration by confocal microscopy on a Leica TCS SP5 microscope (Leica Microsystems, Wetzlar, Germany). Fluorophores were excited using an argon laser at 488 nm (GFP) and bright-ﬁeld images were collected using the transmitted light detector. 4.5. Vector construction and genetic transformation The ORF sequence was inserted into the vector pSN1301 vector [28] under the control of the Cauliﬂower mosaic virus (CaMV) 35S promoter via the KpnI and SacI sites (forward, 50 -GGGGTACCATGGCTAGATGTGCGCCT-30 KpnI site underlined) and reverse, 50 CGAGCTCTTAGATAGACATGAAAACAC-30 SacI site underlined) The recombinant plasmid was electroporated into A tumefaciens (EHA105) for Arabidopsis transformation using the ﬂoral dip method [29], and T1 transgenic plants were conﬁrmed by PCR analysis using the gene-speciﬁc primers of LcSAIN2 as described above. 4.6. Salt stress analysis and osmolytes content measurement For the salt treatment, two T3 generation (Line1 and Line 8) and wild-type (WT) seeds were surface-sterilized and sown on MS medium. Seven-day-old Arabidopsis seedlings were transferred to MS agar plates supplemented with 150 mM NaCl for another 3 weeks to assess their survivability and at least 40 plants of each transgenic line or WT were used for calculating the survival rates. To determine the effects of NaCl on root growth, 4-day-old plants grown on vertically standing MS agar plates were transferred to vertically standing plates containing 0e200 mM NaCl for 7 d and the root elongation was calculated. All assays were repeated at least three times and the error bars indicated the standard deviation (SD). Three-week-old transgenic or WT plants were transferred to half-strength MS medium supplemented with 150 mM NaCl. After 0, 1, and 2 d salt treatment, the leaves of Arabidopsis wild-type and transgenic lines were harvested. Total soluble sugar content was measured as described previously [30], and proline content was determined according to a previously described method [31]. Brieﬂy, leaves were harvested, weighted, and extracted in 3% sulfosalicylic acid. Two microliters of supernatant of each extract was incubated with 3 mL of ninhydrin reagent (2.5% (w/v) ninhydrin, 60% (v/v) glacial acetic acid, 40% 6 M phosphoric acid) and 2 mL of glacial acetic acid at 100 C for 40 min, and the reaction was terminated in an ice bath. Toluene (5 mL) was added and the absorbance was measured spectrophotoelectrically at the wavelength of 520 nm using a UVB 2450 UV spectrophotometer (SHIMADZU, Japan). Each date point had three replicates and the error bars indicated the standard deviation (SD). 4.7. Statistical analysis The data of Arabidopsis seedling growth parameters, soluble sugar and proline content were subjected to ANOVA analysis using SPSS 15.0, and the results were edited in Excel. Acknowledgments We thank Professor Shaun Bushman at Forage & Range Research Laboratory of Utah State University for his critical reading of the manuscript. This work was supported by the National Natural Science Foundation of China (31170316), the National High Technology Research and Development Program of China (“863”, 2011AA100209), the Knowledge Innovation Program of the Chinese Academy of Sciences (KSCX2-EW-B-05), and Project of Ningxia Agricultural Comprehensive Development Ofﬁce (NNTK-11-04; NTKJ-2012-03). References [1] J.S. Boyer, Plant productivity and environment, Science 218 (1982) 443e448. [2] L. Xiong, K.S. Schumaker, J.K. Zhu, Cell signaling during cold, drought, and salt stress, Plant Cell. 14 (2002) S165eS183. [3] K. Yamaguchi-Shinozaki, K. Shinozaki, Transcriptional regulatory networks in cellular responses and tolerance to dehydration and cold stresses, Annu. Rev. Plant Biol. 57 (2006) 781e803. [4] N. Mitsuda, M. Ohme-Takagi, Functional analysis of transcription factors in Arabidopsis, Plant Cell. Physiol. 50 (2009) 1232e1248. [5] L. Zhang, G. Zhao, J. Jia, X. Liu, X. Kong, Molecular characterization of 60 isolated wheat MYB genes and analysis of their expression during abiotic stress, J. Exp. Bot. 63 (2012) 203e214. [6] X. Kong, J. Pan, M. Zhang, X. Xing, Y. Zhou, Y. Liu, D.P. Li, D.Q. Li, ZmMKK4, a novel group C mitogen-activated protein kinase kinase in maize (Zea mays), confers salt and cold tolerance in transgenic Arabidopsis, Plant Cell. Environ. 34 (2011) 1291e1303. [7] A.S.N. Reddy, G.S. Ali, H. Celesnik, I.S. Day, Coping with stresses: roles of calcium-and calcium/calmodulin-regulated gene expression, Plant Cell. 23 (2011) 2010e2032. [8] J.B. Chen, S.M. Wang, R.L. Jing, X.G. Mao, Cloning the PvP5CS gene from common bean (Phaseolus vulgaris) and its expression patterns under abiotic stresses, J. Plant Physiol. 166 (2009) 12e19. [9] R.R. Finkelstein, S.S.L. Gampala, C.D. Rock, Abscisic acid signaling in seeds and seedlings, Plant Cell. 14 (2002) S15eS45. [10] D. Bartels, R. Sunkar, Drought and salt tolerance in plants, Crit. Rev. Plant Sci. 24 (2005) 23e58. [11] K. Shinozaki, K. Yamaguchi-Shinozaki, Gene networks involved in drought stress response and tolerance, J. Exp. Bot. 58 (2007) 221e227. [12] K. Nakashima, Y. Ito, Yamaguchi-Shinozaki, Transcriptional regulatory networks in response to abiotic stresses in Arabidopsis and grasses, Plant Physiol. 149 (2009) 88e95. [13] Y.F. Bai, X.G. Han, J.G. Wu, Z.Z. Chen, L.H. Li, Ecosystem stability and compensatory effects in the Inner Mongolia grassland, Nature 431 (2004) 181e184. [14] Z.P. Liu, Z.Y. Chen, J. Pan, X. Li, M. Su, L. Wang, H. Li, G. Liu, Phylogenetic relationships in Leymus (Poaceae: Triticeae) revealed by the nuclear ribosomal internal transcribed spacer and chloroplast trnL-F sequences, Mol. Phylogenet. Evol. 46 (2008) 278e289. [15] R. Munns, R.A. James, A. Läuchli, Approaches to increasing the salt tolerance of wheat and other cereals, J. Exp. Bot. 57 (2006) 1025e1043. [16] E. Nevo, G.X. Chen, Drought and salt tolerances in wild relatives for wheat and barley improvement, Plant Cell. Environ. 33 (2010) 670e685. X. Li et al. / Plant Physiology and Biochemistry 64 (2013) 52e59 [17] G.M. Xia, H.M. Chen, Plant regeneration from intergeneric somatic hybridization between Triticum astivum L. and Leymus chinensis (Trin.) Tzvel, Plant Sci. 120 (1996) 197e203. [18] S.R. Larson, M. Kishii, H. Tsujimoto, L. Qi, P. Chen, G.R. Lazo, K.B. Jensen, R.R.C. Wang, Leymus EST linkage maps identify 4NsL-5NsL reciprocal translocation, wheat-Leymus chromosome introgressions, and functionally important gene loci, Theor. Appl. Genet. 124 (2012) 189e206. [19] C. Liu, S. Li, M. Wang, G.M. Xia, A transcriptomic analysis reveals the nature of salinity tolerance of a wheat introgression line, Plant Mol. Biol. 78 (2012) 159e169. [20] X.J. Peng, X.Y. Ma, W.H. Fan, M. Su, L.Q. Cheng, I. Alam, B.H. Lee, D.M. Qi, S.H. Shen, G.S. Liu, Improved drought and salt tolerance of Arabidopsis thaliana by transgenic expression of a novel DREB gene from Leymus chinensis, Plant Cell. Rep. 30 (2011) 1493e1502. [21] S.H. An, H.W. Choi, I.S. Hwang, J.K. Hong, B.K. Hwang, A novel pepper membrane-located receptor-like protein gene CaMRP1 is required for disease susceptibility, methyl jasmonate insensitivity and salt tolerance, Plant Mol. Biol. 67 (2008) 519e533. [22] T.N. Petersen, S. Brunak, G. Von Heijne, H. Nielsen, SignalP 4.0: discriminating signal peptides from transmembrane regions, Nat. Meth. 29 (2011) 785e786. [23] A. Krogh, B. Larsson, G. Von Heijne, E.L. Sonnhammer, Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes, J. Mol. Biol. 305 (2001) 567e580. [24] K.C. Chou, H.B. Shen, Plant-mPLoc: a top-down strategy to augment the power for predicting plant protein subcellular localization, PLoS ONE 5 (2010) e11335. [25] Y.G. Liu, N. Mitsukawa, T. Oosumi, R.F. Whittier, Efﬁcient isolation and mapping of Arabidopsis thaliana T-DNA insert junctions by thermal asymmetric interlaced PCR, Plant J. 8 (1995) 457e463. [26] K. Higo, Y. Ugawa, M. Iwamot, T. Korenaga, Plant cis-acting regulatory DNA elements (PLACE) database: 1999, Nucleic Acids Res. 27 (1999) 297e300. [27] K.J. Livak, T.D. Schmittgen, Analysis of relative gene expression data using OO CT method, Methods 25 (2001) real-time quantitative PCR and the 2 402e408. [28] L. Ge, H. Chen, J.F. Jiang, Y. Zhao, M.L. Xu, Y.Y. Xu, K. Chong, Over expression of OsRAA1 causes pleiotropic phenotypes in transgenic rice plants, including altered leaf, ﬂower, and root development and root response to gravity, Plant Physiol. 135 (2004) 1502e1513. 59 [29] S.J. Clough, A.F. Bent, Floral dip: a simpliﬁed method for Agrobacteriummediated transformation of Arabidopsis thaliana, Plant J. 16 (1998) 735e743. [30] R.W. Bailey, The reaction of pentoses with anthrone, Biochem. J. 68 (1958) 669e672. [31] D.P. Shan, J.G. Huang, Y.T. Yang, Y.H. Guo, C.A. Wu, G.D. Yang, Z. Gao, C.C. Zheng, Cotton GhDREB1 increases plant tolerance to low temperature and is negatively regulated by gibberellic acid, New Phytol. 176 (2007) 70e81. [32] E. Abraham, G. Rigo, G. Szekely, R. Nagy, C. Koncz, L. Szabados, Light-dependent induction of proline biosynthesis by abscisic acid and salt stress is inhibited by brassinosteroid in Arabidopsis, Plant Mol. Biol. 51 (2003) 363e372. [33] K. Liu, L. Wang, Y. Xu, N. Chen, Q. Ma, F. Li, K. Chong, Overexpression of OsCOIN, a putative cold inducible zinc ﬁnger protein, increased tolerance to chilling, salt and drought, and enhanced proline level in rice, Planta 226 (2007) 1007e1016. [34] S. Li, C. Xu, Y. Yang, G. Xia, Functional analysis of TaDi19A, a salt-responsive gene in wheat, Plant Cell. Environ. 33 (2010) 117e129. [35] Y.J. Hao, W. Wei, Q.X. Song, H.W. Chen, Y.Q. Zhang, F. Wang, H.F. Zou, G. Lei, A.G. Tian, W.K. Zhang, B. Ma, J.S. Zhang, S.Y. Chen, Soybean NAC transcription factors promote abiotic stress tolerance and lateral root formation in transgenic plants, Plant J. 68 (2011) 302e313. [36] X. He, X. Hou, Y. Shen, Z. Huang, TaSRG, a wheat transcription factor, signiﬁcantly affects salt tolerance in transgenic rice and Arabidopsis, FEBS Lett. 585 (2011) 1231e1237. [37] Y. He, W. Li, J. Lv, Y. Jia, M. Wang, G. Xia, Ectopic expression of a wheat MYB transcription factor gene, TaMYB73, improves salinity stress tolerance in Arabidopsis thaliana, J. Exp. Bot. 63 (2012) 1511e1522. [38] A. Yang, X. Dai, W.H. Zhang, A R2R3-type MYB gene, OsMYB2, is involved in salt, cold, and dehydration tolerance in rice, J. Exp. Bot. 63 (2012) 2541e2556. [39] M. Cui, W. Zhang, Q. Zhang, Z. Xu, Z. Zhu, F. Duan, R. Wu, Induced overexpression of the transcription factor OsDREB2A improves drought tolerance in rice, Plant Physiol. Biochem. 49 (2011) 1384e1491. [40] L. Szabados, A. Savouré, Proline: a multifunctional amino acid, Trends Plant Sci. 15 (2010) 89e97. [41] M. Cvikrová, L. Gemperlová, J. Dobrá, O. Martincová, I.T. Prásil, J. Gubis, R. Vanková, Effect of heat stress on polyamine metabolism in proline-overproducing tobacco plants, Plant Sci. 182 (2012) 49e58. [42] N. Verbruggen, C. Hermans, Proline accumulation in plants: a review, Amino Acids. 35 (2008) 753e759.