我校又一学生在SCI期刊上发表文章.pdf

Online Resources Development and characterization of 33 microsatellite loci for the tiger frog Hoplobatrachus rugulosus (Wiegmann, 1834) through transcriptome sequencing Zhiqiang Chen1, 2, Guohua Ding1, *, Yanmei Wang1, Jing Xu1, Zhihua Lin1 1. College of Ecology, Lishui University, Lishui 323000, Zhejiang, China 2. College of Animal Science and Technology, Zhejiang A & F University, Lin'an 311300, Zhejiang, China * Corresponding author; e-mail: guwoding@qq.com Running headline: Development of microsatellite for a frog 1 Abstract. The tiger frog Hoplobatrachus rugulosus (Wiegmann, 1834) is a large robust dicroglossid frog widely distributed in southern China, Malaysia, Myanmar, Vietnam and Thailand. The escaped bred tiger frog introduced from Thailand hybridized with Chinese native population that maybe affect the genetic diversity of local Chinese tiger frogs. However, previous microsatellite loci of this species cannot offer enough information to construct the genetic map. Here, we reported 33 new microsatellite loci from transcriptome sequencing for H. rugulosus. Alleles ranged between 1 and 10 per locus and only one locus (HRT001) was monomorphic. The polymorphic information content, observed and expected heterozygosity were 0-0.794, 0-0.969 and 0-0.831, respectively. None of the loci was observed in linkage disequilibrium and two loci (HRT023 and HRT068) were deviated from Hardy-Winberg equilibrium after Bonferroni correction for multiple tests. These transcriptome-derived microsatellite markers will be used to study genetic divergence and construct the genetic map in H. rugulosus. Keywords: Dicroglossidae; genetic diversity; Hoplobatrachus rugulosus; microsatellite; transcriptome 2 The tiger frog Hoplobatrachus rugulosus (Wiegmann, 1834) is a large robust dicroglossid frog, which is widely distributed in southern China, Malaysia, Myanmar, Vietnam and Thailand (Yu et al. 2015). The native frogs in China is called Chinese tiger frog, which listed in Appendix II of CITES as one of Class II national protected species in China (Fei et al. 2012). The Chinese native population of the species declined due to habitat destruction and over-hunting (Shao et al. 2009). The bred frog introduced from Thailand is called Thailand tiger frog by Chinese, and widely reared in many farmers of China as an edible frog (Yu et al. 2015). However, Chinese and Thailand tiger frogs still had been identified as H. rugulosus according to Frost’s taxonomic methods (Frost 2018). When escaped Thailand tiger frog from farms hybridized with Chinese native population, that could affect the genetic diversity of local Chinese tiger frogs (Yu et al. 2015). Microsatellites usually applied in the studies of species identifying, population genetics and genetic map due to their high variability and abundance. Nine polymorphic microsatellite loci have been isolated for the Chinese tiger frog via magnetic beads enrichment protocol (Shao et al. 2009). Furthermore, such a few microsatellite loci cannot offer enough information to understand the level of genetic divergence between native and bred frogs. For the rapid microsatellite isolation, the next-generation sequencing technology has been used by analyzing a reference transcriptome de novo assembled from RNA-seq data and expressed sequence tags in H. rugulosus in this study. Chinese tiger frogs were obtained from the froggery of Lishui University. After anaesthetization by 0.05% MS-222 (Sigma), ovary and testis tissues were respectively collected and immediately frozen in liquid nitrogen and stored at -80°C. Ovary or testis tissues from three individual frogs were subjected to RNA extraction using Trizol reagent (TaKaRa, Dalian, China). After total RNA isolation, cDNA library 3 construction and de novo assembly of transcriptome, we collected unigene database, constructed microsatellite library with MISA software, and designed primer pairs with Primer 3 software. Based on ≥ 2 repeat units as a motif and ≥ 20 bp of microsatellite sequence, 211 primer pairs could be design. We randomly chose fifty primer pairs to synthesize and tested in a cultivated native population of H. rugulosus (total 32 individuals) from Jiangxi Province, China. Genomic DNAs of 32 individuals were extracted from toe muscle tissues using the DNeasy Tissue Kit (Qiagen). A nested PCR method with M13 tail (5'-CACGACGTTGTAAAACGAC-3')-labeled primers was used (Shuelke 2000). M13 tail was added to the 5' ends of all forward primers, and a FAM fluorescent labeled M13 primer was added to the PCR mix. The reaction volume of each PCR mixture was 25 μL, containing 100 ng genomic DNA, 12 μL Premix Taq (TaKaRa, Japan), 5 μM of each forward, FAM-M13 and reverse primers. Conditions of the PCR amplification are as follows: 95°C (5 min), then 30 cycles at 95°C (30 s) / Ta (the optimal annealing temperatures, see table 1) (30 s) / 72°C (30 s), followed by 8 cycles 95°C (30 s) / 53°C (30 s) / 72°C (30 s), and a further extension at 72°C for 10 min. Thirty-three microsatellite loci were successfully amplified. The PCR products were genotyped on an ABI 3730 sequencer (Applied Biosystems) and analyzed with GeneMarker v1.8 software. Number of alleles (NA), observed heterozygosity (HO), expected heterozygosity (HE) and polymorphic information content (PIC) were calculated with Cervus 2.0 software (Marshall et al. 1998). Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium were determined with Fstat 2.9.3.2 software (Goudet 1995). Thirty-three primer pairs were successfully amplified, and all loci except two (HRT001 and HRT024) were showed a significant genetic variation (HE > 0.1). All genetic characteristics of the 33 loci for H. 4 rugulosus are shown in table 1. The NA, heterozygosities (HO and HE) and PIC ranged from 1 to 10 (mean ± SD = 5.303 ± 2.325), 0 to 0.969 (mean ± SD = 0.502 ± 0.237), 0 to 0.831 (mean ± SD = 0.609 ± 0.201), 0 to 0.794 (mean ± SD = 0.552 ± 0.197), respectively. No significant linkage disequilibrium was observed after Bonferroni correction for multiple tests (P > 0.05). Of the 33 loci, two (HRT023 and HRT068) deviated significantly from HWE testing (P < 0.05; Table 1) after Bonferroni correction for multiple tests. Overall, twenty-two loci had high polymorphism degree (PIC > 0.5), ten loci had low polymorphism degree (PIC < 0.5), and one locus (HRT001) was monomorphic (Table 1). These transcriptome-derived markers will be used to study genetic divergence and level of hybridization in H. rugulosus. Acknowledgements Our experimental procedures complied with the current laws on animal welfare and research in China. This study was funded by National Science Foundation of China (31500308), Zhejiang Provincial National Science Foundation of China (LQ16C040001), China Postdoctoral Science Foundation (2016M601843) and Key Research Projects of Lishui City (20151206, SH2017001). We thank Jing-Yi Chen and Hua-Li Hu for their help during the study. References Fei L., Ye C.Y., Jiang J.P. 2012 Colored atlas of Chinese amphibians and their distributions. Sichuan Science and Technology Publishing House, Chengdu, China. Frost D.R. 2018 Amphibian species of the world: an online reference. Version 6.0 (date of access: 31 January, 2018). American Museum of Natural History, New York, USA. Goudet J. 1995 FSTAT: a computer program to calculate F-statistics. J. Hered. 86, 485–486. 5 Marshall T.C., Slate J., Kruuk L.E.B., Pemberton J.M. 1998 Statistical confidence for likelihood-based paternity inference in natural populations. Mol. Ecol. 7, 639–655. Schuelke M. 2000 An economic method for the fluorescent labeling of PCR fragments. Nat. Biotechnol. 18, 233–234. Shao C., Wang Y., Qiao N.N. 2009 Isolation and characterization of microsatellite loci in tiger frog (Hoplobatrachus rugulosus). Conserv. Genet. 10, 1601–1603. Yu D.N., Zhang J.Y., Li P., Zheng R.Q., Shao C. 2015 Do cryptic species exist in Hoplobatrachus rugulosus? an examination using four nuclear genes, the cyt b gene and the complete MT genome. PLoS ONE 10, e0124825. 6 Table 1 Characterization of 33 transcriptome-derived microsatellite loci developed for Hoplobatrachus rugulosus. M13 is marked by underlines. Ta: annealing temperature of primer pairs; N: number of individual genotyped; NA: number of alleles; Size range: size range of fragment; bp: base pair; HO: observed heterozygosity; HE: expected heterozygosity; PIC: polymorphic information content; PHWE: probability of deviation for the Hardy–Weinberg equilibrium (P-value). *: significant deviation from Hardy–Weinberg equilibrium after Bonferroni correction for multiple tests (P < 0.05). Locus Ta Primer sequences (5'-3') Repeat motif Size range N (GenBank #) NA (℃) HRT004 F: CACGACGTTGTAAAACGACTGGAGTTGCGGGACAAAGTT MG912875 R: CCCTGTGGGCACTAAGCTAC HRT009 F: CACGACGTTGTAAAACGACTCAGCTGCTGGCCACATTAA MG912876 R: CCTGGGGCAATTTCTCCAGT HRT014 F: CACGACGTTGTAAAACGACGCTTCAAGCACACTACAACTCA MG912877 R: AGCCGAGCTGGTATGTGATT HRT021 F: CACGACGTTGTAAAACGACGGAACACCATGGATTTCGATGT MG912878 R: ATCGGCGGCTCATTGTGTAA HRT005 F: CACGACGTTGTAAAACGACGCAAAAGGTATGCCACAAAGC MG912879 R: AGGCTTCCACGCAGTCATAC HRT041 F: CACGACGTTGTAAAACGACGTCCAAGTGTTGTGCTGTGC MG912880 R: GTCAATTGGCCAGCATGGTG HRT011 F: CACGACGTTGTAAAACGACAACTTGCTGTGTCCTCCTCG MG912881 R: GCCGACACTCCGATACAGAG HRT042 F: CACGACGTTGTAAAACGACCCACGGTCCCTGTGTTGTAA MG912882 R: TATTCCCCCATGGTCCCTGT HRT047 F: CACGACGTTGTAAAACGACCACCCTGAACTGAGACCGAA MG912883 R: AGTGTTGCGTGACAAACTGA HRT030 F: CACGACGTTGTAAAACGACCAGAAGGGGGACAACACCAA MG912884 R: GTCTGCGCATTGTTCCCATC Ho HE PIC PHWE (bp) (GAG)7 60 32 3 277-283 0.469 0.502 0.444 0.7667 (TGA)5-A-(GAG)5 60 32 2 224-227 0.313 0.268 0.229 0.4470 (CA)13 60 32 8 141-160 0.313 0.492 0.443 1.0000 (TTGA)5 60 32 4 280-290 0.625 0.666 0.599 0.7652 (GAG)5-G-(GA)5-ACGAC-(AG)7 60 32 5 232-236 0.281 0.581 0.528 1.0000 (AC)15 60 31 9 239-285 0.710 0.798 0.752 0.9197 (TCCA)5 60 30 6 117-170 0.600 0.697 0.629 0.9273 (TG)14 60 32 10 225-259 0.531 0.831 0.794 1.0000 (GT)10 60 32 9 262-286 0.781 0.752 0.703 0.4303 (CAT)7 60 32 4 206-233 0.219 0.642 0.563 1.0000 7 HRT033 F: CACGACGTTGTAAAACGACTGCACTTAGCTGAGTATGCCA MG912885 R: TAGGGGGCCATTTCTGCTTG HRT019 F: CACGACGTTGTAAAACGACTCACAACAGCCCAGCGTTAT MG912886 R: CAATGGATGGCAGGTGTCCT HRT035 F: CACGACGTTGTAAAACGACGTAGTGCTGGCAGAAGGGAG MG912887 R: GGGATGGGGATTTCTTGGCA HRT006 F: CACGACGTTGTAAAACGACGTGGGTTTTTGTCTGGCCAC MG912888 R: ACCAGCTAAAACGTGGCCTT HRT037 F: CACGACGTTGTAAAACGACTGCGTGTGGTCACTCTCTTC MG912889 R: TCAAGGTGAGCTCCGGAAAC HRT022 F: CACGACGTTGTAAAACGACCACCAACTCCCGGCTTAGAG MG912890 R: CCCCTTTCCTGTGCCTCAAT HRT003 F:CACGACGTTGTAAAACGACTGGATGCATGGACAAAGAGAGA MG912891 R: CCTCTGTCTGTCCACCCTCT HRT023 F: CACGACGTTGTAAAACGACCTGAACAGGCAGGGTAAGGG MG912892 R: AGACTTGCTAGAACCGCACC HRT015 F: CACGACGTTGTAAAACGACTCAGGCCCAACAAAGCTTCT MG912893 R: TGAGCTTATAACTCAGAATGGTGGT HRT024 F: CACGACGTTGTAAAACGACAGGCTGCTGTTGAGCTTCAT MG912894 R: ACTTAGGGGGACAAGACAACA HRT068 F: CACGACGTTGTAAAACGACACATTGTGGTGCAGCCTTCT MG912895 R: GGGACAGTGTTCTAGCACGT HRT025 F: CACGACGTTGTAAAACGACCGTTGGTTCCCTCTCTGGAC MG912896 R: AGTGGATGGGGATGGCTTTG HRT036 F: CACGACGTTGTAAAACGACTCAGCACCAACTTAAAGATTCACA MG912897 R: AGAGTTGACTCCGTGTGCAG (TAA)7 60 27 7 263-278 0.593 0.746 0.693 0.9803 (AC)10 60 32 5 193-201 0.719 0.780 0.732 0.8606 (AC)14 60 31 7 249-275 0.484 0.809 0.767 1.0000 (ACCG)5 60 32 2 180-184 0.375 0.437 0.337 0.8894 (GCT)7 60 32 3 267-276 0.469 0.557 0.461 0.9061 (AT)10 60 32 5 244-252 0.750 0.675 0.602 0.2167 (ATGG)5 60 22 4 107-147 0.318 0.418 0.375 0.9591 (TC)7-C-(CT)10 60 32 5 282-298 0.906 0.703 0.649 0.0015* (AC)11 60 30 8 229-257 0.833 0.740 0.688 0.1470 (TCC)7 60 32 2 242-245 0.063 0.062 0.059 0.9788 (CATA)8 60 32 7 159-183 0.969 0.805 0.762 0.0106* (GT)11 60 32 7 257-285 0.594 0.767 0.716 0.9939 (AAAC)5 60 23 7 164-196 0.565 0.763 0.714 0.9955 8 HRT027 F: CACGACGTTGTAAAACGACGCCGAGCAAATGTCCAATCC MG912898 R: GTCCCTCCCAGACTCTTCCT HRT002 F: CACGACGTTGTAAAACGACTGCCTTTCTTCCCCCATGTC MG912899 R: CTCCCCCTACACCCTACACA HRT031 F: CACGACGTTGTAAAACGACCTGGGAGCCTGGTTACCTTG MG912900 R: TCCCCGCTGTTTACCTTCAC HRT001 F: CACGACGTTGTAAAACGACAGTGTTGTGATTGATGGCCCT MG912901 R: AGGGTGGTGGTAGTAAGGCA HRT049 F: CACGACGTTGTAAAACGACATCCTTTATGAGCACCCGGC MG912902 R: TGGCCCACTGTGCATTACAT HRT010 F: CACGACGTTGTAAAACGACGGACGTAGACTGCACACACA MG912903 R: AGTGTGCATGTGACAGCAGA HRT050 F: CACGACGTTGTAAAACGACGTCACTAACAGGCAGATGAAGA MG912904 R: ACAGGGTTAGGAACGCACTG HRT038 F: CACGACGTTGTAAAACGACGTCATGTGCAGTCCTCCGAT MG912905 R: ATTTGGGCAGACAGACAGGG HRT066 F: CACGACGTTGTAAAACGACACCAAGCCCCAATCTAACAGT MG912906 R: GGGAGAGAGGGAGTGTGAGT HRT080 F: CACGACGTTGTAAAACGACTTCATCGGCTGTGAGGACAC MG912907 R: AGGAGTGAAACTCTGCAGGC (CT)8-CA-(CT)6 60 29 5 239-247 0.276 0.657 0.576 1.0000 (CTC)7 60 32 6 126-144 0.531 0.629 0.587 0.9652 (GT)13 60 32 8 264-302 0.438 0.750 0.712 1.0000 (ATGC)5 60 32 1 223 0 0 0 na (ATAG)5 60 31 3 240-252 0.452 0.531 0.416 0.8606 (AC)12 60 32 6 123-139 0.625 0.658 0.614 0.8045 (TA)6-TGT-(AC)7 60 32 3 259-263 0.375 0.419 0.339 0.8273 (TG)10 60 27 4 147-156 0.074 0.660 0.576 1.0000 (TC)12 60 32 4 114-126 0.594 0.567 0.46 0.4227 (GAG)7 60 32 5 164-182 0.719 0.746 0.685 0.7606 9